Share 0
Share
A- A A+
View in English
auf Deutsch lesen
View in German
The High-Tech Cell


US $10.00
View Item
Mitochondrial Eve and the 3 "Daughters of Noah"


US $10.00
View Item
Evolution's Achilles' Heels
by Nine Ph.D. scientists

US $14.00
View Item
Evolution's Achilles' Heels DVD


US $19.00
View Item

Četverodimenzionalan ljudski genom prkosi naturalističkim objašnjenjima

napisao Robert Carter
preveo Zlatko Madzar

Objavljeno: 6. listopada 2016. (GMT+10)
Ecoli-bacterium
Figure 1: Usporedba nadzora transkripcije /prijepisa u E. Coli (lijevo) s grafičkim prikazom računalnoga sustava Linux (desno). Bakterijska stanica sposobna je nadzirati mnogo proteinski kôdiranih gena (zelene crte na donjem dijelu) s relativno malim brojem kontrola (žuta i ljubičasta linija). Linux, očit ishod inteligentnog dizajna, daleko zaostaje po tome što zahtijeva mnogo više visoko-stupanjskih uputa kako bi nadzirao relativno nekoliko izlaza. Od Yan et al. 2010.1

Ljudski genom najsloženiji je računalni operativni sustav u ikojemu poznatom svemiru. On nadzire najsloženiju biokemiju što radi s točnošću pojedinačne molekule. On nadzire interakcijsku mrežu stotina tisuća proteina. To je prekrasno svjedočanstvo Božje stvaralačke briljantnosti i izvrstan primjer znanstvenoga bankrota Neo-Darwinove teorije. Zašto? Jer što je život više složen, to manje postaje održiva Teorije evolucije. Super složeni strojevi ne mogu biti zakrpani sa slučajnošću ili će se razbiti. I super-složeni strojevi ne nastaju iz nasumičnih promjena.

Ja sam ozbiljan kad uspoređujem genom s operativnim sustavom računala. Jedini problem s ovom analogijom jeste taj da mi nemamo računala što se mogu usporediti s genomom u pojmovima složenosti ili učinkovitosti. Ta podudarnost djeluje samo na većini osnovnoga stupnja, ali to je ono što čini ovu usporedbu toliko silnom. Nakon milijuna sati pisanja i otkrivanja pogrešaka bili smo jedino vođeni stvaranju operativnih sustava što mogu pokrenuti laptop ili server, a i oni se ruše, često. Genom, pak, pokreće hiper-složeni stroj nazvan ljudsko tijelo. Ustroj ova dva sustava temeljito je i drukčiji. Tim sastavljen od računalnih znanstvenika, biofizičara, i stručnjaka bioinformatike (drugim riječima, stvarno pametnih ljudi) usporedili su genom niže E. coli bakterije na Linux operativnome sustavu (slika 1) i otkrili da su naši operativni sustavi što je napravio čovjek mnogo manje učinkoviti jer su “vrlo teški”.1 Ispada da bakterijski genom ima nekoliko visoko-stupanjskih uputa što nadziru nekoliko srednje-stupanjskih procesa, koji naizmjence nadziru ogroman broj proteinski kôdiranih gena. Linux je suprotnost. On jer mnogo teži i kao takav mnogo manje učinkovit za dobivanja napravljenih stvari. Bakterija može napraviti mnogo više s manje nadziranja. Predviđam da će proučavanje genetike utjecati na budući razvoj računala.

Također, naša računala koriste relativno jednostavne programe. Programeri govore o “ulozi kôda”. Svi smo naučili u matematici da je crta jedno-dimenzionalni objekt. Dakle naši su računalni programi u osnovi jedno-dimenzionalni. Ljudski genom radi u četiri dimenzije. To je jedno od najvećih svjedočanstava dostupnosti Božje stvaralačke briljantnosti.

human-Y-chromosome
Slika 2: Početak ljudskoga Y kromosoma kao što se vidi s napravom kao čunj za vizualizaciju genoma.2 U ovome prikazu, možemo vidjeti mnoge ponavljajuće DNK elemente (pruge). Ova ponavljanja možda ne uključuju “gene”, ali služe za držanje gena na posebnome mjestu u 3D prostoru (o 3.-oj dimenziji bit će raspravljeno dolje). Veliko crno područje je opetovano kako bi se preskočio nacrt ljudskoga genoma (još nisu imali tehnologiju za slaganje u velikoj mjeri ponavljajuće DNK). Postoji mnogo informacija upakiranih u četiri slova korištenih za slovkanje prve dimenzije genoma, ali to nije čak ni vrh ledenog brijega od sveukupnog sadržaja informacije u genomu.

Prva dimenzija: DNK molekule

Ljudski genom dug je oko 1,8 m. Sve se to uklapa u staničnu jezgru. Učinimo li to vidljivim, ako biste htjeli napraviti vaš DNK da bude debeo kao ljudska kosa, onda biste imali više od 50 kilometara DNK, zbijene u nešto što je otprilike veličine loptice za golf. Već po tome, moramo shvatiti da je Bog nevjerojatan inženjer.

Ako bismo promatrali postupni niz slova u DNK, to bi moglo izgledati kao ovo:

CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGTGGGTGGGAGCAGATTAGAGAATAA AAGCAGACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGTCCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTTGGGTCCACACTGCCTTTATGAGCTGTGACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCCAGTGAGACCACAACCCCACCAGAAAGAAGAAACTCAGAACACATCTGAACATCAGAAGAAACAAACTCCGGACGCGCCACCTTTAAGAACTGTAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGAAGTCAGTGAGACCAAGAACCCACCAATTCCAGACACACTAGGACCCTGAGACAACCCCTAGAAGAGCACCTGGTTGATAACCCAGTTCCCATCTGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAGCTCCTCATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGGGACCAGGGACAGCCCGTTGCATGAGCCCCTGGACTCTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTGGGACAGCCCTGTACATGAGCTCCTGGTCTGTAACACAGTTCCCCTGTGGGGATTTAGGGACTTGGGCCTT

Ovo je prvih 700 slova ljudskoga Y kromosoma. Nije baš impresivno, zar ne? Ali ako uzmemo taj isti postupni niz i zamijenimo četiri slova s četiri obojena piksela, dobit ćete nešto što izgleda kao slika 2.

Prva dimenzija genoma jednostavno je redoslijed slova. Ona slovkaju gene i ti geni govore stanici neka napravi stvari. To zapravo i nije tako komplicirano, ali stvari će se promijeniti.

Druga dimenzija: interaktivna mreža

Druga dimenzija genoma bavi se s načinom kako jedan dio DNK uzajamno djeluje s drugim dijelom. Kao što smo već vidjeli, možete izvući prvu dimenziju vrlo lako. Ali ako ste pokušali izvući drugu dimenziju vi biste najprije morali izvući mnoge strelice što povezuju različite dijelove linearnog niza DNK. Bilo bi nemoguće izvući čitavu mrežu uzajamnoga djelovanja toga genoma, tako mali uzorak neće biti dovoljan. Mikro RNA-i (miRNA) vrlo su male molekule (oko 22 nukleotida) koje su uključene u regulaciju djelovanja gena. Slika 3 prikazuje dio miRNA regulatorne mreže dok ona djeluje na samo 13 gena koji su regulirani prema gore povezano s aterosklerozom (otvrdnuće arterija). Ovi geni su na meti 262 mikroRNA-a, stvarajući 372 “regulatorna odnosa”. Na slici 3 nisu uključena druga 33 gena koji su regulirani prema dolje od 295 miRNA-a kad se tijelo bavi s ovim stanjem. Zapamtite, ovo je samo jedan mali djelić 2.-e dimenzije genoma!

microRNA
Slika 3: Mali dio mikro RNA regulatorne mreža služi kao izvrstan primjer druge dimenzije genoma. Ovdje, narančasta područja predstavljaju 13 gena koji su regulirani prema gore povezano s aterosklerozom od 262 miRNA-a (zelene točkice s naljepnicama) što su, naizmjence, proizvedene u drugim dijelovima genoma. (Prema Lin et al. 20143)

Druga dimenzija bavi se stvarima kao primjerice specifičnim čimbenicima, pojačivačima, represorima, aktivatorima, i transkripcijskim čimbenicima. To su proteini koji su kôdirani u DNK, ali oni se kreću prema drugome dijelu genoma nakon što stvore i nešto uključuju ili isključuju. Ali postoje dodatne stvari što se događaju u ovoj dimenziji. Tijekom procesa proizvodnje proteina, gen je “pročitan” od stanice tijekom procesa nazvanog transkripcija /prepisivanje. Ovdje, DNK je preslikana u molekulu nazvanu RNA. Zatim se ta RNA prevodi u protein. Imamo izvrsnu animaciju ovoga procesa na našoj multimedijalnoj stranici. Ali u procesu nazvanome post-transkripcijska /prijepisna regulacija, RNA može biti nedjelatna ili djelatna od drugih čimbenika (kao mikroRNA-i) kôdiranih drugdje u genomu.

Masivni, multi-milijunski-dolarski ENCODE projekt otkriva nešto o genomu koji se još uvijek pokušava u potpunosti doseći. Jedna od najvećih misterija jeste ta kako samo oko 22.000 gena može proizvesti više od 300.000 različitih proteina. Odgovor je da stanica prolazi kroz proces nazvan alternativno spajanje, gdje su geni spojeni i kockasti a različiti dijelovi korišteni su od različitih stanica u različitim vremenima i pod različitim okolnostima kako bi proizveli mnoštvo različitih proteina. Ovaj nevjerojatno složen proces samo je jedan dio te druge dimenzije genoma.

Treća dimenzija: 3-D DNK arhitektura

chromosomes
Slika 4. 3D pozicioniranje ljudskih kromosoma unutar jezgre. Genima koji su ukopani duboko ne može se lako pristupiti, tako da je 3D preklapanje kromosoma izuzetno važno za cjelokupno djelovanje genoma. (Od Bolzera5)

Treća dimenzija bavi se time kako oblik molekule DNK utječe na ekspresiju i nadzor različitih gena. Naučili smo da dijelovi DNK koji su ukopani duboko unutar namotane DNK ne mogu biti lako aktivirani.4 Dakle geni koji se koriste često uglavnom su lako dostupni. Tako, kada je Bog ispisao obavijest u genomu koji pripada jedno-dimenzionalnoj građi, On je namjeravano stavio stvari u određeni red tako da budu na pravome mjestu kad će DNK biti omotana u 3-D oblik.

Jedno od velikih otkrića iz Human Genome Project bilo je to da se geni koji se koriste zajedno ne moraju nužno pojaviti jedan blizu drugoga u genomu. Tvrdnje kao: “To je samo otpad” i “Genom nije ništa više negoli milijuni godina genetskih nesretnih slučajeva” isplivale su na površinu. Ovo nije dugo trajalo, međutim, odjednom su ljudi počeli istraživati kako je genom organiziran u jezgri,5 oni su shvatili da, ne samo kako svaki kromosom ima poseban položaj u jezgri, nego su geni koji se koriste zajedno općenito nađeni jedan do drugoga u 3D prostoru, čak i kad su nađeni na različitim kromosomima!

Četvrta dimenzija: promjene u prve tri dimenzije

Četvrta dimenzija genoma bavi se s načinom kako se prve tri dimenzije mijenjanju u četvrtu dimenziju, vrijeme. Da, ovo ste dobro pročitali. Oblik (3.-a dimenzija), interaktivna mreža (2.-a dimenzija), i nizovi slova (1.-a dimenzija) sve se mijenja. Ovo toliko daleko nadmašuje naša najsuvremenija računala da čak ni usporedba nije više pravična.

Ova četvrta dimenzija može biti slikovito prikazana na nekoliko načina. Znamo da različite stanice jetre imaju različit broj kromosoma.6 To je obzirom na činjenicu da jetra treba puno preslika određenih gena koji su uključeni u metabolizam i detoksikaciju. Umjesto punjenja genoma s mnogo preslika tih gena, jetra čini samo preslike za svoju vlastitu uporabu. Također znamo da različite moždane stanice imaju različit broj i mjesta različitih transposona.7 To su “skakući geni” za koje su evolucionisti mislili kako moraju biti ostaci od drevnih virusnih infekcija. Problem je, jesu li oni suštinski za razvoj ljudskog mozga. Jeste li to shvatili? Genom dinamički reprogramira sâm sebe. To je nešto čime su se računalni znanstvenici dugo borili. Kako možete napraviti samo-izmjenjujući kôd koji ne ide bez nadzora? Također znamo da su transposoni opasni za nadziranje razvoja embrija u mišu.8 Toliko o njihovu nazivanju “otpad DNK”!

Zaključak

Genom je multi-dimenzionalni operativni sustav za ultra-složeno biološko računalo, s ugrađenim ispravljanjem grešaka i samostalnom izmjenom kôdova. Postoje mnogostruki preklapajući DNK kôdovi, RNA kôdovi, i strukturni kôdovi. Postoje DNK geni i RNA geni. Genom je namjerno bio osmišljen s velikom količinom redundancije /zalihosti ili preobilja [višak obavijesti u komunikaciji radi sigurnijeg prijenosa obavijesti, sprječavanja nesporazuma i boljeg nadzora nad prenošenjem obavijesti – Hrvatska enciklopedija; op. prev.], namjeravano, od visoko-inteligentnog bića koje koristi inženjerska načela zvuka tijekom njegove izgradnje. Unatoč redundancije, on prikazuje nevjerojatan stupanj zbijenosti kao pukih 22.000 gena ili tako proteinsko-kôdiranih gena da kombinacijski stvaraju nekoliko stotina tisuća različitih proteina.

Imam izazov za evolucioniste: Objasnite podrijetlo genoma! Charles Darwin napisao je u svojoj knjizi o podrijetlu vrsta:

Ako može biti predočeno da postoji bilo koji složeni organ, koji nikako nije mogao biti oblikovan brojnim, uzastopnim, neznatnim promjenama, moja bi teorija u potpunosti propala.

Znam da je ovaj navod bio zlorabljen (od obje strane u raspravi) ali razmislimo o tome na trenutak. Što je život jednostavniji, lakše ga je objasniti s Darwinovskim pojmovima. S druge strane, što život postaje složenijim, on uzrokuje više tvrdoglavih poteškoća za Teoriju evolucije. Upravo smo vidjeli da je genom oprečan jednostavnosti. To bi trebalo biti vrlo neugodno za sve darviniste.

Tvrdim da se genom nije mogao pojaviti kroz poznate naturalističke procese. Evolucionist koji želi preuzeti taj izazov mora nam dati izvodljiv scenarij, uključujući izvor informacijskih promjena, izvješće o količini mutacijske neophodnosti, i opis selektivnih sila neophodnosti, sve unutar primjerenoga vremenskog okvira. Oni će otkriti kako evolucija ne može učiniti ono što oni zahtijevaju, čak ni tijekom milijuna godina.

Usput, ovo je bio kratak sažetak o informaciji sadržanoj na DVD-u The High Tech Cell. Ako želite više informacija, predlažem da kupite kopiju u našoj Internet trgovini.

Povezani članci

Preporučene bilješke

  1. Yan, K.-K., etal., Usporedba genoma s računalnim operativnim sustavima u pojmovima topologije i evolucije njihovih regulatornih mreža za nadzor. PNAS 107(20):9186-9191, 2010. Natrag na tekst.
  2. Seaman, J., i Sanford, J., Skittle: alat za vizualizaciju 2-dimenzionalnoga genoma. BMC Bioinformatics 10:452, 2009. Natrag na tekst.
  3. Lin, M., Zhao, W., i Weng, J., Rasijecanje mehanizma ateroskleroze karotide sa stajališta regulacije, International Journal of Molecular Medicine34:1458-1466, 2014. Natrag na tekst.
  4. van Berkum, N.L., Hi-C: metoda proučavanja tro-dimenzionalne arhitekture genoma, Journal of Visualized Experiments 6(39):1869, 2010. Natrag na tekst.
  5. Bolzer, A., etal., Tro-dimenzionalne preslike jezgre svih kromosoma u ljudskome muškom fibroblastu i prometafaza rozeta, PLoSBiol 3(5):e157, 2005. Natrag na tekst.
  6. Duncan, A.W., etal., Prijenosnik ploidnosti zrelih hepatocita kao izvor genetske varijabilnosti, Nature 467:707-710, 2010. Natrag na tekst.
  7. Baillie, J.K., etal., Somatski retro transpozicijski sažeci genetike i stablo ljudskoga mozga, Nature 479:534-537, 2011. Natrag na tekst.
  8. Tomkins, J., 2012. Razvoj elemenata koji pomiču kôdiranje embrija; icr.org/article/6928, 25. srpanj 2012. Natrag na tekst.

Creation.com reaches millions of people each year–many of these aren't believers in our Creator and Savior Jesus Christ. How will we keep reaching them without your support? Please consider a small gift today. Support this site

Comments closed
Article closed for commenting.
Available only from day of publication.
Copied to clipboard
11840
Product added to cart.
Click store to checkout.
In your shopping cart

Remove All Products in Cart
Go to store and Checkout
Go to store
Total price does not include shipping costs. Prices subject to change in accordance with your country’s store.